acetyltransferase mutant Search Results


86
Molecular Instruments chat b4 molecular instruments
Chat B4 Molecular Instruments, supplied by Molecular Instruments, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/acetyltransferase+mutant/buffer+probe+wash/pm40945510-217-172-173
Average 86 stars, based on 1 article reviews
chat b4 molecular instruments - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

90
Promega chloramphenicol acetyltransferase reporter vector pgl3 basic
A) SARI full length <t>promoter/pGL3-Luc</t> or SARI deletion mutant promoter/PGL3-Luc constructs were transfected into HeLa cells. Twenty-four h later the cells were treated with IFN-β (1000 U/ml) or infected with Ad.vec (100 pfu/cell) or Ad.mda-7 (100 pfu/cell) for 24 h after which cell lysates were collected for luciferase assays. B) i): HeLa cells were infected with Ad.vec or Ad.SARI at 10 pfu/cell and nuclei were prepared from the treated cells. The isolated nuclei were used to label preinitiated RNA transcription with [α-32P] UTP in vitro, and the purified RNA was hybridized to a dot blot carrying an equivalent amount of a SARI cDNA. The transcription rate of GAPDH served as control. ii) HeLa cells were treated as described in panel A and total RNA was purified, blotted onto a nylon membrane, and Northern blotting was done with a SARI, mda-7/IL-24 or GAPDH cDNA. C) 3′-UTR region of SARI mRNA was cloned into PGL3-basic-Luc vector (Luc-3′UTR) and three independent clones (along with control vector) were transfected into HeLa cells for 24 h followed by infection with Ad.vec or Ad.mda-7 (100 pfu/cell for 24 h) and cell lysates were collected for luciferase assays. The data is presented as the ratio of Ad.mda-7 to Ad.vec treated cells. All experiments were performed at least three times, and data represent mean ± S.D. * p<0.05 RLU is significantly higher than PGL-3 Luc control cells. D) P69 cells were infected with Ad.vec or Ad.mda-7 (20 pfu/cell for 24 h) after which Actinomycin D (0.5 μg/ml) was added for the indicated times. Total RNA was collected to perform Northern blotting using a SARI cDNA.
Chloramphenicol Acetyltransferase Reporter Vector Pgl3 Basic, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/acetyltransferase+mutant/pgl3+basic/pmc03915776-67-12-19
Average 90 stars, based on 1 article reviews
chloramphenicol acetyltransferase reporter vector pgl3 basic - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

92
Addgene inc p300 acetyltransferase activity defective mutant
a , All putative lysine acetyltransferases (KATs) in C . elegans and their human homologues. The worm KATs were validated/identified by searching the C . elegans protein database for proteins with a conserved <t>acetyltransferase</t> domain, and high amino acid sequences identities of the known human KATs . b , Role of KATs in UPR mt activation in C . elegans . hsp-6p::gfp worms were fed with control (ev) or cco-1 (40%) RNAi in combination with RNAi targeting different KATs (60%). c , d , cbp-1 RNAi attenuates the UPR mt activation induced by cco-1 (c) or mrps-5 (d) RNAi in a dose-dependent manner. RNAi targeting cco-1 or mrps-5 occupied 40%. cbp-1 RNAi occupied 10-60%. Control RNAi was used to supply to a final 100% of RNAi for all conditions. e , Schematic diagram showing the different regions regulated by the two different cbp-1 RNAi, and the two <t>CBP/p300</t> inhibitors (PF-CBP1 and A-485). KIX, kinase-inducible domain interacting domain; Br, bromodomain; HAT, histone acetyltransferase domain; a.a., amino acids; n.t., nucleotides. f , The alternative cbp-1 RNAi ( cbp-1 _2) also inhibits UPR mt activation. RNAi targeting mrps-5 or spg-7 occupies 40%, cbp-1 RNAi occupies 25%. g , A-485 attenuates UPR mt activation induced by mrps-5 RNAi in a dose-dependent manner. hsp-6p::gfp worms were fed with control or mrps-5 RNAi (40%), in combination with 0-20 μM A-485. h , i , RNAi that specifically targets cbp-2 or cbp-3 failed to abolish UPR mt activation in hsp-6p::gfp worms. Photos (h) and qRT-PCR-results ( n = 4 biologically independent samples) (i) of hsp-6p::gfp worms fed with control, cco-1 (40%), cbp-1 (25%), cbp-2 (Ahringer library) or cbp-3 RNAi. Error bars denote SEM. Statistical analysis was performed by two-tailed unpaired Student’s t -test. j , Schematic diagram showing the protein structure of CBP-1, CBP-2 and CBP-3. The numbers in red indicate the amino acid sequence identities between two proteins in comparison. k - m , cbp-1 RNAi attenuates the UPR ER activation induced by tunicamycin (5 μg/ml) (k), hsp-3 (l) or enpl-1 (m) RNAi in hsp-4p::gfp worms. RNAi targeting hsp-3 or enpl-1 occupies 40%, cbp-1 RNAi occupies 25%, atfs-1 RNAi occupies 60%. n , cbp-1 RNAi does not affect the cytosolic UPR (UPR CYT )/heat shock response activation induced by heat shock. hsp16.2p::gfp reporter worms were fed with different percentages of cbp-1 RNAi as indicated. As positive control, heat shock for 8 h at 31°C could induce the UPR CYT and cbp-1 RNAi did not block this response. Scale bars, 0.3 mm.
P300 Acetyltransferase Activity Defective Mutant, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/acetyltransferase+mutant/pSG5-HA-p300-DY1399+(Plasmid+%2389095)/pmc07116894-208-12-18
Average 92 stars, based on 1 article reviews
p300 acetyltransferase activity defective mutant - by Bioz Stars, 2026-10
92/100 stars
  Buy from Supplier

99
Thermo Fisher phosphate acetyltransferase mutant 12 m5 psol1 7 e coli top10 invitrogen plasmids pjc7 ap r
Bacterial strains and plasmids
Phosphate Acetyltransferase Mutant 12 M5 Psol1 7 E Coli Top10 Invitrogen Plasmids Pjc7 Ap R, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/acetyltransferase+mutant/Phosphate/pmc00544202-134-53-64
Average 99 stars, based on 1 article reviews
phosphate acetyltransferase mutant 12 m5 psol1 7 e coli top10 invitrogen plasmids pjc7 ap r - by Bioz Stars, 2026-10
99/100 stars
  Buy from Supplier

93
Addgene inc pcdna3β flag cbp ld ha cat
Bacterial strains and plasmids
Pcdna3β Flag Cbp Ld Ha Cat, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/acetyltransferase+mutant/pcDNA3%CE%B2-FLAG-CBP-LD-HA+(Plasmid+%2332906)/pm40200339-260-13-26
Average 93 stars, based on 1 article reviews
pcdna3β flag cbp ld ha cat - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

99
ATCC k7n1 aac 3 iv orit aac 3 iv oritaatl aatr aac 3 iv oritaatl aatr tcgcgcgcgcttcgttcgggacgaagaggcaga mutant atcc k7n133bp neo bac1 k7n1
Bacterial strains and plasmids
K7n1 Aac 3 Iv Orit Aac 3 Iv Oritaatl Aatr Aac 3 Iv Oritaatl Aatr Tcgcgcgcgcttcgttcgggacgaagaggcaga Mutant Atcc K7n133bp Neo Bac1 K7n1, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/acetyltransferase+mutant/Plasmid/pmc08792006__41467_2022_27955_MOESM1_ESM-27-94-101
Average 99 stars, based on 1 article reviews
k7n1 aac 3 iv orit aac 3 iv oritaatl aatr aac 3 iv oritaatl aatr tcgcgcgcgcttcgttcgggacgaagaggcaga mutant atcc k7n133bp neo bac1 k7n1 - by Bioz Stars, 2026-10
99/100 stars
  Buy from Supplier

99
ATCC nat10 mutant cell lines hela
Bacterial strains and plasmids
Nat10 Mutant Cell Lines Hela, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/acetyltransferase+mutant/HeLa/pmc06295233-487-10-19
Average 99 stars, based on 1 article reviews
nat10 mutant cell lines hela - by Bioz Stars, 2026-10
99/100 stars
  Buy from Supplier

88
Addgene inc acetyltransferase mutant
Bacterial strains and plasmids
Acetyltransferase Mutant, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/acetyltransferase+mutant/pAdEasy+Flag+GCN5+(Plasmid+%2314106)/pm38240344-386-13-23
Average 88 stars, based on 1 article reviews
acetyltransferase mutant - by Bioz Stars, 2026-10
88/100 stars
  Buy from Supplier

93
Addgene inc deactivated cas9 histone acetyltransferase p300 fusion protein
(A) Work flow used to refine motif enrichment analysis and focus on enriched transcription factors (TFs) important in airway epithelial biology and BEC-SEs. (B) Ingenuity analysis indicating TFs with motif enrichment in asthma DERs and BEC-SEs were associated with various processes in epithelial biology including epithelial to mesenchymal transition (EMT). (C) Genome tracks depicting H3K27ac across loci encoding epithelium-dominant TFs encompassed by BEC-SEs and asthma DERs. Asthma=red, healthy=blue. (D) Enriched motifs and matching TFs identified by HOMER (see methods). (E) H3K27ac profiles of healthy (blue) and asthma (red) BECs at epithelium-dominant TF binding sites identified via ChIP-Seq and those predicated by HOMER (*; see also ) (F) TLR3 gene expression could be induced with single DER-specific gRNAs in an acetylation-dependent manner (n=3, Mean ±SEM). (G) Genome tracks depicting H3K27ac in BECs across the SERPINB2 . Acetylation <t>(dCas9-P300-Core)</t> was targeted to the TSS (pool 1) of SERPINB2 and upstream within an asthma-associated SE (pools 2-4) using gRNAs (yellow boxes top tracks). No induction of gene expression was observed when targeting distal enhancer elements. Guide RNAs to IL1RN used as controls. Core - only P300 constructs transfected (n=3, Mean ±SEM, ** P <0.01, ANOVA/Tukeys multiple comparisons).
Deactivated Cas9 Histone Acetyltransferase P300 Fusion Protein, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/acetyltransferase+mutant/pcDNA-dCas9-p300+Core+(D1399Y)+(Plasmid+%2361358)/bio_rxiv__282889-193-8-29
Average 93 stars, based on 1 article reviews
deactivated cas9 histone acetyltransferase p300 fusion protein - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

86
Mutant Mouse Resource & Research Center chat egfp gh293gsat mmucd mice rrid mmrrc 000296 ucd
(A) Work flow used to refine motif enrichment analysis and focus on enriched transcription factors (TFs) important in airway epithelial biology and BEC-SEs. (B) Ingenuity analysis indicating TFs with motif enrichment in asthma DERs and BEC-SEs were associated with various processes in epithelial biology including epithelial to mesenchymal transition (EMT). (C) Genome tracks depicting H3K27ac across loci encoding epithelium-dominant TFs encompassed by BEC-SEs and asthma DERs. Asthma=red, healthy=blue. (D) Enriched motifs and matching TFs identified by HOMER (see methods). (E) H3K27ac profiles of healthy (blue) and asthma (red) BECs at epithelium-dominant TF binding sites identified via ChIP-Seq and those predicated by HOMER (*; see also ) (F) TLR3 gene expression could be induced with single DER-specific gRNAs in an acetylation-dependent manner (n=3, Mean ±SEM). (G) Genome tracks depicting H3K27ac in BECs across the SERPINB2 . Acetylation <t>(dCas9-P300-Core)</t> was targeted to the TSS (pool 1) of SERPINB2 and upstream within an asthma-associated SE (pools 2-4) using gRNAs (yellow boxes top tracks). No induction of gene expression was observed when targeting distal enhancer elements. Guide RNAs to IL1RN used as controls. Core - only P300 constructs transfected (n=3, Mean ±SEM, ** P <0.01, ANOVA/Tukeys multiple comparisons).
Chat Egfp Gh293gsat Mmucd Mice Rrid Mmrrc 000296 Ucd, supplied by Mutant Mouse Resource & Research Center, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/acetyltransferase+mutant/000296+chat+egfp+gh293gsat+mice+mmrrc+mmucd+rrid+tg+ucd/bio_rxiv__2025__10__09__681259-42-0-3
Average 86 stars, based on 1 article reviews
chat egfp gh293gsat mmucd mice rrid mmrrc 000296 ucd - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

93
Addgene inc acetyl transferase mutant pcdna3 1 p300 hat
(A) Work flow used to refine motif enrichment analysis and focus on enriched transcription factors (TFs) important in airway epithelial biology and BEC-SEs. (B) Ingenuity analysis indicating TFs with motif enrichment in asthma DERs and BEC-SEs were associated with various processes in epithelial biology including epithelial to mesenchymal transition (EMT). (C) Genome tracks depicting H3K27ac across loci encoding epithelium-dominant TFs encompassed by BEC-SEs and asthma DERs. Asthma=red, healthy=blue. (D) Enriched motifs and matching TFs identified by HOMER (see methods). (E) H3K27ac profiles of healthy (blue) and asthma (red) BECs at epithelium-dominant TF binding sites identified via ChIP-Seq and those predicated by HOMER (*; see also ) (F) TLR3 gene expression could be induced with single DER-specific gRNAs in an acetylation-dependent manner (n=3, Mean ±SEM). (G) Genome tracks depicting H3K27ac in BECs across the SERPINB2 . Acetylation <t>(dCas9-P300-Core)</t> was targeted to the TSS (pool 1) of SERPINB2 and upstream within an asthma-associated SE (pools 2-4) using gRNAs (yellow boxes top tracks). No induction of gene expression was observed when targeting distal enhancer elements. Guide RNAs to IL1RN used as controls. Core - only P300 constructs transfected (n=3, Mean ±SEM, ** P <0.01, ANOVA/Tukeys multiple comparisons).
Acetyl Transferase Mutant Pcdna3 1 P300 Hat, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/acetyltransferase+mutant/pcDNA3%2E1-300(HAT-)+(Plasmid+%2323254)/pmc06721388-184-6-15
Average 93 stars, based on 1 article reviews
acetyl transferase mutant pcdna3 1 p300 hat - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

92
Addgene inc mutation overexpression plasmid pice flag nat10 sir g641e oemut
(A) Work flow used to refine motif enrichment analysis and focus on enriched transcription factors (TFs) important in airway epithelial biology and BEC-SEs. (B) Ingenuity analysis indicating TFs with motif enrichment in asthma DERs and BEC-SEs were associated with various processes in epithelial biology including epithelial to mesenchymal transition (EMT). (C) Genome tracks depicting H3K27ac across loci encoding epithelium-dominant TFs encompassed by BEC-SEs and asthma DERs. Asthma=red, healthy=blue. (D) Enriched motifs and matching TFs identified by HOMER (see methods). (E) H3K27ac profiles of healthy (blue) and asthma (red) BECs at epithelium-dominant TF binding sites identified via ChIP-Seq and those predicated by HOMER (*; see also ) (F) TLR3 gene expression could be induced with single DER-specific gRNAs in an acetylation-dependent manner (n=3, Mean ±SEM). (G) Genome tracks depicting H3K27ac in BECs across the SERPINB2 . Acetylation <t>(dCas9-P300-Core)</t> was targeted to the TSS (pool 1) of SERPINB2 and upstream within an asthma-associated SE (pools 2-4) using gRNAs (yellow boxes top tracks). No induction of gene expression was observed when targeting distal enhancer elements. Guide RNAs to IL1RN used as controls. Core - only P300 constructs transfected (n=3, Mean ±SEM, ** P <0.01, ANOVA/Tukeys multiple comparisons).
Mutation Overexpression Plasmid Pice Flag Nat10 Sir G641e Oemut, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/acetyltransferase+mutant/pICE-FLAG-NAT10-siR-G641E+(Plasmid+%2359366)/pm37463108-207-9-17
Average 92 stars, based on 1 article reviews
mutation overexpression plasmid pice flag nat10 sir g641e oemut - by Bioz Stars, 2026-10
92/100 stars
  Buy from Supplier

Image Search Results


A) SARI full length promoter/pGL3-Luc or SARI deletion mutant promoter/PGL3-Luc constructs were transfected into HeLa cells. Twenty-four h later the cells were treated with IFN-β (1000 U/ml) or infected with Ad.vec (100 pfu/cell) or Ad.mda-7 (100 pfu/cell) for 24 h after which cell lysates were collected for luciferase assays. B) i): HeLa cells were infected with Ad.vec or Ad.SARI at 10 pfu/cell and nuclei were prepared from the treated cells. The isolated nuclei were used to label preinitiated RNA transcription with [α-32P] UTP in vitro, and the purified RNA was hybridized to a dot blot carrying an equivalent amount of a SARI cDNA. The transcription rate of GAPDH served as control. ii) HeLa cells were treated as described in panel A and total RNA was purified, blotted onto a nylon membrane, and Northern blotting was done with a SARI, mda-7/IL-24 or GAPDH cDNA. C) 3′-UTR region of SARI mRNA was cloned into PGL3-basic-Luc vector (Luc-3′UTR) and three independent clones (along with control vector) were transfected into HeLa cells for 24 h followed by infection with Ad.vec or Ad.mda-7 (100 pfu/cell for 24 h) and cell lysates were collected for luciferase assays. The data is presented as the ratio of Ad.mda-7 to Ad.vec treated cells. All experiments were performed at least three times, and data represent mean ± S.D. * p<0.05 RLU is significantly higher than PGL-3 Luc control cells. D) P69 cells were infected with Ad.vec or Ad.mda-7 (20 pfu/cell for 24 h) after which Actinomycin D (0.5 μg/ml) was added for the indicated times. Total RNA was collected to perform Northern blotting using a SARI cDNA.

Journal: Cancer research

Article Title: Novel mechanism of MDA-7/IL-24 cancer-specific apoptosis through SARI induction

doi: 10.1158/0008-5472.CAN-13-1062

Figure Lengend Snippet: A) SARI full length promoter/pGL3-Luc or SARI deletion mutant promoter/PGL3-Luc constructs were transfected into HeLa cells. Twenty-four h later the cells were treated with IFN-β (1000 U/ml) or infected with Ad.vec (100 pfu/cell) or Ad.mda-7 (100 pfu/cell) for 24 h after which cell lysates were collected for luciferase assays. B) i): HeLa cells were infected with Ad.vec or Ad.SARI at 10 pfu/cell and nuclei were prepared from the treated cells. The isolated nuclei were used to label preinitiated RNA transcription with [α-32P] UTP in vitro, and the purified RNA was hybridized to a dot blot carrying an equivalent amount of a SARI cDNA. The transcription rate of GAPDH served as control. ii) HeLa cells were treated as described in panel A and total RNA was purified, blotted onto a nylon membrane, and Northern blotting was done with a SARI, mda-7/IL-24 or GAPDH cDNA. C) 3′-UTR region of SARI mRNA was cloned into PGL3-basic-Luc vector (Luc-3′UTR) and three independent clones (along with control vector) were transfected into HeLa cells for 24 h followed by infection with Ad.vec or Ad.mda-7 (100 pfu/cell for 24 h) and cell lysates were collected for luciferase assays. The data is presented as the ratio of Ad.mda-7 to Ad.vec treated cells. All experiments were performed at least three times, and data represent mean ± S.D. * p<0.05 RLU is significantly higher than PGL-3 Luc control cells. D) P69 cells were infected with Ad.vec or Ad.mda-7 (20 pfu/cell for 24 h) after which Actinomycin D (0.5 μg/ml) was added for the indicated times. Total RNA was collected to perform Northern blotting using a SARI cDNA.

Article Snippet: The full-length SARI promoter construct and deletion mutants were cloned into the chloramphenicol acetyltransferase (CAT) reporter vector pGL3 basic (Promega) to produce the SARI /pGL3 or SARI deletion mutant/PGL3 constructs.

Techniques: Mutagenesis, Construct, Transfection, Infection, Luciferase, Isolation, In Vitro, Purification, Dot Blot, Northern Blot, Clone Assay, Plasmid Preparation

a , All putative lysine acetyltransferases (KATs) in C . elegans and their human homologues. The worm KATs were validated/identified by searching the C . elegans protein database for proteins with a conserved acetyltransferase domain, and high amino acid sequences identities of the known human KATs . b , Role of KATs in UPR mt activation in C . elegans . hsp-6p::gfp worms were fed with control (ev) or cco-1 (40%) RNAi in combination with RNAi targeting different KATs (60%). c , d , cbp-1 RNAi attenuates the UPR mt activation induced by cco-1 (c) or mrps-5 (d) RNAi in a dose-dependent manner. RNAi targeting cco-1 or mrps-5 occupied 40%. cbp-1 RNAi occupied 10-60%. Control RNAi was used to supply to a final 100% of RNAi for all conditions. e , Schematic diagram showing the different regions regulated by the two different cbp-1 RNAi, and the two CBP/p300 inhibitors (PF-CBP1 and A-485). KIX, kinase-inducible domain interacting domain; Br, bromodomain; HAT, histone acetyltransferase domain; a.a., amino acids; n.t., nucleotides. f , The alternative cbp-1 RNAi ( cbp-1 _2) also inhibits UPR mt activation. RNAi targeting mrps-5 or spg-7 occupies 40%, cbp-1 RNAi occupies 25%. g , A-485 attenuates UPR mt activation induced by mrps-5 RNAi in a dose-dependent manner. hsp-6p::gfp worms were fed with control or mrps-5 RNAi (40%), in combination with 0-20 μM A-485. h , i , RNAi that specifically targets cbp-2 or cbp-3 failed to abolish UPR mt activation in hsp-6p::gfp worms. Photos (h) and qRT-PCR-results ( n = 4 biologically independent samples) (i) of hsp-6p::gfp worms fed with control, cco-1 (40%), cbp-1 (25%), cbp-2 (Ahringer library) or cbp-3 RNAi. Error bars denote SEM. Statistical analysis was performed by two-tailed unpaired Student’s t -test. j , Schematic diagram showing the protein structure of CBP-1, CBP-2 and CBP-3. The numbers in red indicate the amino acid sequence identities between two proteins in comparison. k - m , cbp-1 RNAi attenuates the UPR ER activation induced by tunicamycin (5 μg/ml) (k), hsp-3 (l) or enpl-1 (m) RNAi in hsp-4p::gfp worms. RNAi targeting hsp-3 or enpl-1 occupies 40%, cbp-1 RNAi occupies 25%, atfs-1 RNAi occupies 60%. n , cbp-1 RNAi does not affect the cytosolic UPR (UPR CYT )/heat shock response activation induced by heat shock. hsp16.2p::gfp reporter worms were fed with different percentages of cbp-1 RNAi as indicated. As positive control, heat shock for 8 h at 31°C could induce the UPR CYT and cbp-1 RNAi did not block this response. Scale bars, 0.3 mm.

Journal: Nature aging

Article Title: The transcriptional coactivator CBP/p300 is an evolutionarily conserved node that promotes longevity in response to mitochondrial stress

doi: 10.1038/s43587-020-00025-z

Figure Lengend Snippet: a , All putative lysine acetyltransferases (KATs) in C . elegans and their human homologues. The worm KATs were validated/identified by searching the C . elegans protein database for proteins with a conserved acetyltransferase domain, and high amino acid sequences identities of the known human KATs . b , Role of KATs in UPR mt activation in C . elegans . hsp-6p::gfp worms were fed with control (ev) or cco-1 (40%) RNAi in combination with RNAi targeting different KATs (60%). c , d , cbp-1 RNAi attenuates the UPR mt activation induced by cco-1 (c) or mrps-5 (d) RNAi in a dose-dependent manner. RNAi targeting cco-1 or mrps-5 occupied 40%. cbp-1 RNAi occupied 10-60%. Control RNAi was used to supply to a final 100% of RNAi for all conditions. e , Schematic diagram showing the different regions regulated by the two different cbp-1 RNAi, and the two CBP/p300 inhibitors (PF-CBP1 and A-485). KIX, kinase-inducible domain interacting domain; Br, bromodomain; HAT, histone acetyltransferase domain; a.a., amino acids; n.t., nucleotides. f , The alternative cbp-1 RNAi ( cbp-1 _2) also inhibits UPR mt activation. RNAi targeting mrps-5 or spg-7 occupies 40%, cbp-1 RNAi occupies 25%. g , A-485 attenuates UPR mt activation induced by mrps-5 RNAi in a dose-dependent manner. hsp-6p::gfp worms were fed with control or mrps-5 RNAi (40%), in combination with 0-20 μM A-485. h , i , RNAi that specifically targets cbp-2 or cbp-3 failed to abolish UPR mt activation in hsp-6p::gfp worms. Photos (h) and qRT-PCR-results ( n = 4 biologically independent samples) (i) of hsp-6p::gfp worms fed with control, cco-1 (40%), cbp-1 (25%), cbp-2 (Ahringer library) or cbp-3 RNAi. Error bars denote SEM. Statistical analysis was performed by two-tailed unpaired Student’s t -test. j , Schematic diagram showing the protein structure of CBP-1, CBP-2 and CBP-3. The numbers in red indicate the amino acid sequence identities between two proteins in comparison. k - m , cbp-1 RNAi attenuates the UPR ER activation induced by tunicamycin (5 μg/ml) (k), hsp-3 (l) or enpl-1 (m) RNAi in hsp-4p::gfp worms. RNAi targeting hsp-3 or enpl-1 occupies 40%, cbp-1 RNAi occupies 25%, atfs-1 RNAi occupies 60%. n , cbp-1 RNAi does not affect the cytosolic UPR (UPR CYT )/heat shock response activation induced by heat shock. hsp16.2p::gfp reporter worms were fed with different percentages of cbp-1 RNAi as indicated. As positive control, heat shock for 8 h at 31°C could induce the UPR CYT and cbp-1 RNAi did not block this response. Scale bars, 0.3 mm.

Article Snippet: For transfection, plasmids expressing human full-length WT-p300 (Cat. 89094, addgene), and the p300 acetyltransferase activity-defective mutant (Cat. 89095, addgene) , were purchased from addgene and transfected with the Lipofectamine 3000 Reagent (Cat. L3000015, ThermoFisher).

Techniques: Activation Assay, Control, Quantitative RT-PCR, Two Tailed Test, Sequencing, Comparison, Positive Control, Blocking Assay

a , b , cbp-1 RNAi attenuates UPR mt activation induced by cco-1 (a) or mrps-5 (b) knockdown in hsp-6p::gfp worms. For RNAi treatment, RNAi targeting cco-1 or mrps-5 occupies 40%, cbp-1 RNAi occupies 25%, atfs-1 RNAi occupies 60%, control RNAi (ev) was used to supply to a final 100% of RNAi for all conditions. DIC, differential interference contrast image. c , CBP/p300 small-molecule inhibitors A-485 and PF-CBP1 attenuate UPR mt activation in worms. hsp-6p::gfp worms were fed with control or the UPR mt -inducing cco-1 (40%) RNAi, in combination with A-485 (10 μM) or PF-CBP1 (80 μM) treatment. d , e , cbp-1 RNAi abolishes UPR mt activation induced by spg-7 , timm-23 , tomm-40 , cts-1 or dlst-1 RNAi (d), and by antimycin A (2.5 μM) or doxycycline (Dox) (30 μg/ml) (e), in hsp-6p::gfp worms. The atfs-1 RNAi was used as a positive control. RNAi targeting tomm-40 , cts-1 or dlst-1 occupies 40%, cbp-1 RNAi occupies 25%, atfs-1 RNAi occupies 60%. f , Volcano plots showing the effects on gene expression of cco-1 RNAi compared to control RNAi (ev) (left), and of cbp-1 (middle) or atfs-1 (right) knockdown in a cco-1 RNAi background. FC, fold change. Genes dependent on both CBP-1 and ATFS-1 for induction after cco-1 RNAi are highlighted in red (common). Genes dependent on CBP-1, but not ATFS-1, for induction are in blue (CBP-1 only). Genes dependent on ATFS-1, but not CBP-1, for induction are highlighted in yellow (ATFS-1 only). g , Venn diagram of CBP-1-dependent UPR mt genes, that are in common with ATFS-1-dependent UPR mt genes in response to cco-1 RNAi, according to the RNA-seq data. h , i , Functional clustering of the 259 (h) and 247 (i) UPR mt genes as indicated in (g). j . Heat-map of the representative UPR mt genes dependent on CBP-1 for induction during cco-1 knockdown. The color-coded heat-map represents gene expression differences in log 2 FC relatively to control RNAi (ev) condition. Genes dependent on both CBP-1 and ATFS-1 are highlighted in red. Genes dependent on CBP-1, but not ATFS-1, are highlighted in blue. Scale bars, 0.3 mm.

Journal: Nature aging

Article Title: The transcriptional coactivator CBP/p300 is an evolutionarily conserved node that promotes longevity in response to mitochondrial stress

doi: 10.1038/s43587-020-00025-z

Figure Lengend Snippet: a , b , cbp-1 RNAi attenuates UPR mt activation induced by cco-1 (a) or mrps-5 (b) knockdown in hsp-6p::gfp worms. For RNAi treatment, RNAi targeting cco-1 or mrps-5 occupies 40%, cbp-1 RNAi occupies 25%, atfs-1 RNAi occupies 60%, control RNAi (ev) was used to supply to a final 100% of RNAi for all conditions. DIC, differential interference contrast image. c , CBP/p300 small-molecule inhibitors A-485 and PF-CBP1 attenuate UPR mt activation in worms. hsp-6p::gfp worms were fed with control or the UPR mt -inducing cco-1 (40%) RNAi, in combination with A-485 (10 μM) or PF-CBP1 (80 μM) treatment. d , e , cbp-1 RNAi abolishes UPR mt activation induced by spg-7 , timm-23 , tomm-40 , cts-1 or dlst-1 RNAi (d), and by antimycin A (2.5 μM) or doxycycline (Dox) (30 μg/ml) (e), in hsp-6p::gfp worms. The atfs-1 RNAi was used as a positive control. RNAi targeting tomm-40 , cts-1 or dlst-1 occupies 40%, cbp-1 RNAi occupies 25%, atfs-1 RNAi occupies 60%. f , Volcano plots showing the effects on gene expression of cco-1 RNAi compared to control RNAi (ev) (left), and of cbp-1 (middle) or atfs-1 (right) knockdown in a cco-1 RNAi background. FC, fold change. Genes dependent on both CBP-1 and ATFS-1 for induction after cco-1 RNAi are highlighted in red (common). Genes dependent on CBP-1, but not ATFS-1, for induction are in blue (CBP-1 only). Genes dependent on ATFS-1, but not CBP-1, for induction are highlighted in yellow (ATFS-1 only). g , Venn diagram of CBP-1-dependent UPR mt genes, that are in common with ATFS-1-dependent UPR mt genes in response to cco-1 RNAi, according to the RNA-seq data. h , i , Functional clustering of the 259 (h) and 247 (i) UPR mt genes as indicated in (g). j . Heat-map of the representative UPR mt genes dependent on CBP-1 for induction during cco-1 knockdown. The color-coded heat-map represents gene expression differences in log 2 FC relatively to control RNAi (ev) condition. Genes dependent on both CBP-1 and ATFS-1 are highlighted in red. Genes dependent on CBP-1, but not ATFS-1, are highlighted in blue. Scale bars, 0.3 mm.

Article Snippet: For transfection, plasmids expressing human full-length WT-p300 (Cat. 89094, addgene), and the p300 acetyltransferase activity-defective mutant (Cat. 89095, addgene) , were purchased from addgene and transfected with the Lipofectamine 3000 Reagent (Cat. L3000015, ThermoFisher).

Techniques: Activation Assay, Knockdown, Control, Positive Control, Gene Expression, RNA Sequencing, Functional Assay

a , H3K18 and H3K27 acetylation increases in a CBP-1-dependent manner during UPR mt activation induced by cco-1 or mrps-5 RNAi. Western blots of hsp-6p::gfp worms fed with control, cbp-1 , atfs-1 , cco-1 or mrps-5 RNAi. RNAi targeting cbp-1 occupies 25%, atfs-1 , cco-1 or mrps-5 occupies 50%, control RNAi was used to supply to a final 100% of RNAi for all conditions. b , The increase of H3K18Ac and H3K27Ac upon cco-1 RNAi is strongly blocked by chemical inhibition of CBP/p300 with A-485. Western blots of hsp-6p::gfp worms fed with control or cco-1 (50%) RNAi, in combination with DMSO or A-485 (10 μM) treatment. c , Western blots of hsp-6p::gfp worms showing increased H3K18Ac and H3K27Ac during UPR mt activation induced by RNAi targeting different mitochondrial genes as indicated. d , Summary of the H3K27Ac and H3K18Ac ChIP-seq results in worms fed with control or cco-1 RNAi. e - g , Treatment of cco-1 RNAi increases H3K18Ac and H3K27Ac at the genomic loci of representative UPR mt genes including hsp-6 , hsp-60 and timm-23 . Genome tracks showing the ChIP-seq analysis for H3K27Ac and H3K18Ac over the genomic loci of hsp-6 (e), hsp-60 (f) and timm-23 (g) in worms fed with control (ev) or cco-1 RNAi. The two tracks were shown with the same total count range between basal and mitochondrial stress condition for each gene. h , i , Functional clustering of the 4639 (h) and 2283 (i) genes as indicated in (d). j - l , cco-1 RNAi-induced increase of H3K18Ac and H3K27Ac at the loci of representative UPR mt genes is completely blocked by cbp-1 RNAi. ChIP-qPCR analysis of hsp-6 (j), hsp-60 (k) and timm-23 (l) in worms fed with RNAi targeting cco-1 and/or cbp-1 ( n = 4 biologically independent samples). RNAi targeting cco-1 occupies 50%, cbp-1 occupies 25%. ChIP was performed by using antibodies to H3K18Ac or H3K27Ac. Error bars denote SEM. Statistical analysis was performed by ANOVA followed by Tukey post-hoc test. For uncropped gel source data, see .

Journal: Nature aging

Article Title: The transcriptional coactivator CBP/p300 is an evolutionarily conserved node that promotes longevity in response to mitochondrial stress

doi: 10.1038/s43587-020-00025-z

Figure Lengend Snippet: a , H3K18 and H3K27 acetylation increases in a CBP-1-dependent manner during UPR mt activation induced by cco-1 or mrps-5 RNAi. Western blots of hsp-6p::gfp worms fed with control, cbp-1 , atfs-1 , cco-1 or mrps-5 RNAi. RNAi targeting cbp-1 occupies 25%, atfs-1 , cco-1 or mrps-5 occupies 50%, control RNAi was used to supply to a final 100% of RNAi for all conditions. b , The increase of H3K18Ac and H3K27Ac upon cco-1 RNAi is strongly blocked by chemical inhibition of CBP/p300 with A-485. Western blots of hsp-6p::gfp worms fed with control or cco-1 (50%) RNAi, in combination with DMSO or A-485 (10 μM) treatment. c , Western blots of hsp-6p::gfp worms showing increased H3K18Ac and H3K27Ac during UPR mt activation induced by RNAi targeting different mitochondrial genes as indicated. d , Summary of the H3K27Ac and H3K18Ac ChIP-seq results in worms fed with control or cco-1 RNAi. e - g , Treatment of cco-1 RNAi increases H3K18Ac and H3K27Ac at the genomic loci of representative UPR mt genes including hsp-6 , hsp-60 and timm-23 . Genome tracks showing the ChIP-seq analysis for H3K27Ac and H3K18Ac over the genomic loci of hsp-6 (e), hsp-60 (f) and timm-23 (g) in worms fed with control (ev) or cco-1 RNAi. The two tracks were shown with the same total count range between basal and mitochondrial stress condition for each gene. h , i , Functional clustering of the 4639 (h) and 2283 (i) genes as indicated in (d). j - l , cco-1 RNAi-induced increase of H3K18Ac and H3K27Ac at the loci of representative UPR mt genes is completely blocked by cbp-1 RNAi. ChIP-qPCR analysis of hsp-6 (j), hsp-60 (k) and timm-23 (l) in worms fed with RNAi targeting cco-1 and/or cbp-1 ( n = 4 biologically independent samples). RNAi targeting cco-1 occupies 50%, cbp-1 occupies 25%. ChIP was performed by using antibodies to H3K18Ac or H3K27Ac. Error bars denote SEM. Statistical analysis was performed by ANOVA followed by Tukey post-hoc test. For uncropped gel source data, see .

Article Snippet: For transfection, plasmids expressing human full-length WT-p300 (Cat. 89094, addgene), and the p300 acetyltransferase activity-defective mutant (Cat. 89095, addgene) , were purchased from addgene and transfected with the Lipofectamine 3000 Reagent (Cat. L3000015, ThermoFisher).

Techniques: Activation Assay, Western Blot, Control, Inhibition, ChIP-sequencing, Functional Assay, ChIP-qPCR

a , Pearson’s correlation co-expression heat-map for CBP , p300, Kdm6b , Phf8 and UPR mt genes in spleen, pituitary, adrenal and eye of the BXD mouse genetic reference population 43, 52. Positive and negative correlations are indicated in red and blue, respectively. The intensity of the colors corresponds to correlation coefficients. b , Positive correlations between lifespan and CBP transcript levels in spleen, pituitary and adrenal of BXD mice (Pearson’s r , two-sided). c , Positive correlations between lifespan and p300 transcript levels in spleen, pituitary and eye of BXD mice (Pearson’s r , two-sided). d , Circos plot of the expression correlations between CBP/p300 transcripts and the UPR mt gene transcripts in the brain (cerebellar hemisphere), hypothalamus, liver, heart (left ventricle), stomach, pancreas, kidney and small intestine of human samples derived from the Genotype-Tissue Expression (GTEx) database (v8) . Red bar ring: the Pearson’s correlation coefficients ( r ) between UPR mt gene transcripts and CBP (light red) or p300 (dark red). Blue bar ring: the Spearman Rank correlation coefficients ( Rho ) between UPR mt gene transcripts and CBP (light blue) or p300 (dark blue). All correlations were found to be positive.

Journal: Nature aging

Article Title: The transcriptional coactivator CBP/p300 is an evolutionarily conserved node that promotes longevity in response to mitochondrial stress

doi: 10.1038/s43587-020-00025-z

Figure Lengend Snippet: a , Pearson’s correlation co-expression heat-map for CBP , p300, Kdm6b , Phf8 and UPR mt genes in spleen, pituitary, adrenal and eye of the BXD mouse genetic reference population 43, 52. Positive and negative correlations are indicated in red and blue, respectively. The intensity of the colors corresponds to correlation coefficients. b , Positive correlations between lifespan and CBP transcript levels in spleen, pituitary and adrenal of BXD mice (Pearson’s r , two-sided). c , Positive correlations between lifespan and p300 transcript levels in spleen, pituitary and eye of BXD mice (Pearson’s r , two-sided). d , Circos plot of the expression correlations between CBP/p300 transcripts and the UPR mt gene transcripts in the brain (cerebellar hemisphere), hypothalamus, liver, heart (left ventricle), stomach, pancreas, kidney and small intestine of human samples derived from the Genotype-Tissue Expression (GTEx) database (v8) . Red bar ring: the Pearson’s correlation coefficients ( r ) between UPR mt gene transcripts and CBP (light red) or p300 (dark red). Blue bar ring: the Spearman Rank correlation coefficients ( Rho ) between UPR mt gene transcripts and CBP (light blue) or p300 (dark blue). All correlations were found to be positive.

Article Snippet: For transfection, plasmids expressing human full-length WT-p300 (Cat. 89094, addgene), and the p300 acetyltransferase activity-defective mutant (Cat. 89095, addgene) , were purchased from addgene and transfected with the Lipofectamine 3000 Reagent (Cat. L3000015, ThermoFisher).

Techniques: Expressing, Derivative Assay

a , Pearson’s correlation co-expression heat-map for CBP / p300, Kdm6b / Phf8 and UPR mt genes in hippocampus and hypothalamus of the BXD mouse genetic reference population , . Positive and negative correlations are indicated in red and blue, respectively. The intensity of the colors corresponds to correlation coefficients. b , Pearson’s correlation co-expression heat-map for CBP / p300, Kdm6b / Phf8 and UPR mt genes in the brain (whole brain) and prefrontal cortex of the LXS mouse genetic reference population . c , Positive correlations between lifespan and CBP or p300 transcript levels in hippocampus and hypothalamus of BXD mice (Pearson’s r , two-sided). Each dot indicates an independent BXD strain.

Journal: Nature aging

Article Title: The transcriptional coactivator CBP/p300 is an evolutionarily conserved node that promotes longevity in response to mitochondrial stress

doi: 10.1038/s43587-020-00025-z

Figure Lengend Snippet: a , Pearson’s correlation co-expression heat-map for CBP / p300, Kdm6b / Phf8 and UPR mt genes in hippocampus and hypothalamus of the BXD mouse genetic reference population , . Positive and negative correlations are indicated in red and blue, respectively. The intensity of the colors corresponds to correlation coefficients. b , Pearson’s correlation co-expression heat-map for CBP / p300, Kdm6b / Phf8 and UPR mt genes in the brain (whole brain) and prefrontal cortex of the LXS mouse genetic reference population . c , Positive correlations between lifespan and CBP or p300 transcript levels in hippocampus and hypothalamus of BXD mice (Pearson’s r , two-sided). Each dot indicates an independent BXD strain.

Article Snippet: For transfection, plasmids expressing human full-length WT-p300 (Cat. 89094, addgene), and the p300 acetyltransferase activity-defective mutant (Cat. 89095, addgene) , were purchased from addgene and transfected with the Lipofectamine 3000 Reagent (Cat. L3000015, ThermoFisher).

Techniques: Expressing

a , Knockout of CBP/p300 attenuates Dox-induced transcription of key UPR mt genes in MEFs. qRT-PCR-results of wild-type (WT) and CBP/p300 -/- MEFs treated with or without Dox (30 μg/ml) for 24 h ( n = 4 biologically independent samples). b , Diagram of the UPR mt genes that are dependent (blue) or independent (grey) on CBP/p300 for induction upon Dox treatment in MEFs, according to the RNA-seq data. c , Functional clustering of the 197 genes as indicated in (b). d , e , Transcripts ( n = 4 biologically independent samples) (d) and protein levels (e) of CBP/p300 -/- MEFs reconstituted with empty vector, WT-p300 or the D1399Y acetyltransferase activity-defective mutant of p300, after control or Dox (30 μg/ml) treatment for 24 h. f , Western blots showing time-dependent changes of H3K18Ac and H3K27Ac in WT and CBP/p300 -/- MEFs treated with Dox (30 μg/ml) for 0-12 h. g , CBP/p300 is essential for Dox-induced H3K18Ac and H3K27Ac at the promoters of UPR mt genes (e.g. Hspd1 and Hspa9 ). ChIP-qPCR analysis of Hspd1 and Hspa9 in wild-type and CBP/p300 -/- MEFs treated with or without Dox (30 μg/ml) for 3 h ( n = 4 biologically independent samples). ChIP was performed by using antibodies to H3K18Ac or H3K27Ac. h , CBP/p300 acetyltransferase activity inhibitor A-485 strongly suppresses Dox-induced transcription of key UPR mt genes in HepG2 cells. qRT-PCR-results of HepG2 cells pretreated with DMSO or A-485 (5 μM) for 1 h, and then co-treated with or without Dox (30 μg/ml) for 24 h ( n = 4 biologically independent samples). i , Functional clustering of the 299 genes up-regulated upon Dox treatment (30 μg/ml, 24 h) and the CBP/p300 activity-dependency in human HepG2 cells, according to the RNA-seq data with A-485. CBP/p300 activity-dependent genes are indicated in red. j , qRT-PCR-results of HepG2 cells overexpressing empty vector, WT-p300 or the acetyltransferase activity-defective mutant D1399Y-p300 ( n = 4 biologically independent samples). Error bars denote SEM. Statistical analysis was performed by ANOVA followed by Tukey post-hoc test. For uncropped gel source data, see .

Journal: Nature aging

Article Title: The transcriptional coactivator CBP/p300 is an evolutionarily conserved node that promotes longevity in response to mitochondrial stress

doi: 10.1038/s43587-020-00025-z

Figure Lengend Snippet: a , Knockout of CBP/p300 attenuates Dox-induced transcription of key UPR mt genes in MEFs. qRT-PCR-results of wild-type (WT) and CBP/p300 -/- MEFs treated with or without Dox (30 μg/ml) for 24 h ( n = 4 biologically independent samples). b , Diagram of the UPR mt genes that are dependent (blue) or independent (grey) on CBP/p300 for induction upon Dox treatment in MEFs, according to the RNA-seq data. c , Functional clustering of the 197 genes as indicated in (b). d , e , Transcripts ( n = 4 biologically independent samples) (d) and protein levels (e) of CBP/p300 -/- MEFs reconstituted with empty vector, WT-p300 or the D1399Y acetyltransferase activity-defective mutant of p300, after control or Dox (30 μg/ml) treatment for 24 h. f , Western blots showing time-dependent changes of H3K18Ac and H3K27Ac in WT and CBP/p300 -/- MEFs treated with Dox (30 μg/ml) for 0-12 h. g , CBP/p300 is essential for Dox-induced H3K18Ac and H3K27Ac at the promoters of UPR mt genes (e.g. Hspd1 and Hspa9 ). ChIP-qPCR analysis of Hspd1 and Hspa9 in wild-type and CBP/p300 -/- MEFs treated with or without Dox (30 μg/ml) for 3 h ( n = 4 biologically independent samples). ChIP was performed by using antibodies to H3K18Ac or H3K27Ac. h , CBP/p300 acetyltransferase activity inhibitor A-485 strongly suppresses Dox-induced transcription of key UPR mt genes in HepG2 cells. qRT-PCR-results of HepG2 cells pretreated with DMSO or A-485 (5 μM) for 1 h, and then co-treated with or without Dox (30 μg/ml) for 24 h ( n = 4 biologically independent samples). i , Functional clustering of the 299 genes up-regulated upon Dox treatment (30 μg/ml, 24 h) and the CBP/p300 activity-dependency in human HepG2 cells, according to the RNA-seq data with A-485. CBP/p300 activity-dependent genes are indicated in red. j , qRT-PCR-results of HepG2 cells overexpressing empty vector, WT-p300 or the acetyltransferase activity-defective mutant D1399Y-p300 ( n = 4 biologically independent samples). Error bars denote SEM. Statistical analysis was performed by ANOVA followed by Tukey post-hoc test. For uncropped gel source data, see .

Article Snippet: For transfection, plasmids expressing human full-length WT-p300 (Cat. 89094, addgene), and the p300 acetyltransferase activity-defective mutant (Cat. 89095, addgene) , were purchased from addgene and transfected with the Lipofectamine 3000 Reagent (Cat. L3000015, ThermoFisher).

Techniques: Knock-Out, Quantitative RT-PCR, RNA Sequencing, Functional Assay, Plasmid Preparation, Activity Assay, Mutagenesis, Control, Western Blot, ChIP-qPCR

a , Multidimensional scaling (MDS) plot of the RNA-seq profiles of wild-type (WT) and CBP/p300 -/- MEFs treated with or without Dox (30 μg/ml) for 24 h. Note the decreased distance between Dox-treated and un-treated condition in the CBP/p300 -/- background compared to that in WT background. b , CBP/p300 -/- MEFs are insensitive to the treatment of mitochondrial stress inducer Dox. Volcano plots showing the effect of Dox treatment in wild-type (WT) (left) or CBP/p300 -/- (right) MEFs on gene expression. FC, fold change. Genes that were up-regulated (log 2 FC > 0.5, adjusted P < 0.05) during Dox treatment were highlighted in red. Genes that were down-regulated (log 2 FC < -0.5, adjusted P < 0.05) were highlighted in blue. c , Heat-map of the representative UPR mt genes dependent on CBP/p300 for induction in response to Dox treatment in WT and CBP/p300 -/- (KO) MEFs, according to the RNA-seq data. The heat-map was shown in log 2 FC values. d , MDS plot of the RNA-seq profiles of HepG2 cells treated with or without CBP/p300 acetyltransferase activity inhibitor A-485 (5 μM) and/or Dox (30 μg/ml) for 24 h. e , The CBP/p300 catalytic inhibitor A-485 attenuates the effect of Dox on gene expression in HepG2 cells. Volcano plots showing the effect of Dox on gene expression of HepG2 cells in control (DMSO) (left) or A-485 (right) treatment background. FC, fold change. Genes that were up-regulated (log 2 FC > 0.5, adjusted P < 0.05) during Dox treatment were highlighted in red. Genes that were down-regulated (log 2 FC < -0.5, adjusted P < 0.05) were highlighted in blue. f , Diagram of the UPR mt genes that are dependent (orange) or independent (grey) on CBP/p300 activity in response to Dox treatment in HepG2 cells, according to the RNA-seq data with A-485.

Journal: Nature aging

Article Title: The transcriptional coactivator CBP/p300 is an evolutionarily conserved node that promotes longevity in response to mitochondrial stress

doi: 10.1038/s43587-020-00025-z

Figure Lengend Snippet: a , Multidimensional scaling (MDS) plot of the RNA-seq profiles of wild-type (WT) and CBP/p300 -/- MEFs treated with or without Dox (30 μg/ml) for 24 h. Note the decreased distance between Dox-treated and un-treated condition in the CBP/p300 -/- background compared to that in WT background. b , CBP/p300 -/- MEFs are insensitive to the treatment of mitochondrial stress inducer Dox. Volcano plots showing the effect of Dox treatment in wild-type (WT) (left) or CBP/p300 -/- (right) MEFs on gene expression. FC, fold change. Genes that were up-regulated (log 2 FC > 0.5, adjusted P < 0.05) during Dox treatment were highlighted in red. Genes that were down-regulated (log 2 FC < -0.5, adjusted P < 0.05) were highlighted in blue. c , Heat-map of the representative UPR mt genes dependent on CBP/p300 for induction in response to Dox treatment in WT and CBP/p300 -/- (KO) MEFs, according to the RNA-seq data. The heat-map was shown in log 2 FC values. d , MDS plot of the RNA-seq profiles of HepG2 cells treated with or without CBP/p300 acetyltransferase activity inhibitor A-485 (5 μM) and/or Dox (30 μg/ml) for 24 h. e , The CBP/p300 catalytic inhibitor A-485 attenuates the effect of Dox on gene expression in HepG2 cells. Volcano plots showing the effect of Dox on gene expression of HepG2 cells in control (DMSO) (left) or A-485 (right) treatment background. FC, fold change. Genes that were up-regulated (log 2 FC > 0.5, adjusted P < 0.05) during Dox treatment were highlighted in red. Genes that were down-regulated (log 2 FC < -0.5, adjusted P < 0.05) were highlighted in blue. f , Diagram of the UPR mt genes that are dependent (orange) or independent (grey) on CBP/p300 activity in response to Dox treatment in HepG2 cells, according to the RNA-seq data with A-485.

Article Snippet: For transfection, plasmids expressing human full-length WT-p300 (Cat. 89094, addgene), and the p300 acetyltransferase activity-defective mutant (Cat. 89095, addgene) , were purchased from addgene and transfected with the Lipofectamine 3000 Reagent (Cat. L3000015, ThermoFisher).

Techniques: RNA Sequencing, Gene Expression, Activity Assay, Control

When the mitochondria are stressed in response to various intracellular or extracellular stimuli, CBP-1 or the mammalian CBP/p300 act downstream of demethylases JMJD-3.1/JMJD-1.2 or mammalian KDM6B/PHF8, switching the transcription-repressive histone methylation marks (e.g. H3K27Me3) to the transcription-active acetylation marks (e.g. H3K27Ac), and thereby relays the mitochondrial stress signal to the transcriptional induction of diverse UPR mt genes in C . elegans as well as in mammals. Many of these UPR mt effectors play positive roles in the recovery of mitochondrial function, improved immune response and proteostasis, and lifespan extension.

Journal: Nature aging

Article Title: The transcriptional coactivator CBP/p300 is an evolutionarily conserved node that promotes longevity in response to mitochondrial stress

doi: 10.1038/s43587-020-00025-z

Figure Lengend Snippet: When the mitochondria are stressed in response to various intracellular or extracellular stimuli, CBP-1 or the mammalian CBP/p300 act downstream of demethylases JMJD-3.1/JMJD-1.2 or mammalian KDM6B/PHF8, switching the transcription-repressive histone methylation marks (e.g. H3K27Me3) to the transcription-active acetylation marks (e.g. H3K27Ac), and thereby relays the mitochondrial stress signal to the transcriptional induction of diverse UPR mt genes in C . elegans as well as in mammals. Many of these UPR mt effectors play positive roles in the recovery of mitochondrial function, improved immune response and proteostasis, and lifespan extension.

Article Snippet: For transfection, plasmids expressing human full-length WT-p300 (Cat. 89094, addgene), and the p300 acetyltransferase activity-defective mutant (Cat. 89095, addgene) , were purchased from addgene and transfected with the Lipofectamine 3000 Reagent (Cat. L3000015, ThermoFisher).

Techniques: Methylation

a , ATFS-1 was acetylated by CBP-1 in vivo . Flag-tagged ATFS-1 was expressed with or without CBP-1 acetyltransferase domain (CBP-1-HAT) in HEK293T cells, immunoprecipitated with anti-Flag antibody and analyzed by western blots. TCL, total cell lysate. b , ATFS-1 was acetylated by CBP-1 in vitro . Bacterially expressed GST tagged CBP-1-HAT was incubated with Flag-ATFS-1 with or without acetyl-CoA (Ac-CoA) and immunoblotted as indicated. c , Schematic diagram showing the protein structure of ATFS-1 and the acetylated sites identified by mass spectrometry. MTS, mitochondrial targeting sequence; SRR, Serine-rich region; NLS, Nuclear localization signal; LZD, Leucine zipper domain. d , HEK293T cells transfected as indicated were treated with or without TSA (class I/II HDAC inhibitor), or NAM (class III HDAC inhibitor) 8 h before harvesting, and analyzed by western blots. For uncropped gel source data, see .

Journal: Nature aging

Article Title: The transcriptional coactivator CBP/p300 is an evolutionarily conserved node that promotes longevity in response to mitochondrial stress

doi: 10.1038/s43587-020-00025-z

Figure Lengend Snippet: a , ATFS-1 was acetylated by CBP-1 in vivo . Flag-tagged ATFS-1 was expressed with or without CBP-1 acetyltransferase domain (CBP-1-HAT) in HEK293T cells, immunoprecipitated with anti-Flag antibody and analyzed by western blots. TCL, total cell lysate. b , ATFS-1 was acetylated by CBP-1 in vitro . Bacterially expressed GST tagged CBP-1-HAT was incubated with Flag-ATFS-1 with or without acetyl-CoA (Ac-CoA) and immunoblotted as indicated. c , Schematic diagram showing the protein structure of ATFS-1 and the acetylated sites identified by mass spectrometry. MTS, mitochondrial targeting sequence; SRR, Serine-rich region; NLS, Nuclear localization signal; LZD, Leucine zipper domain. d , HEK293T cells transfected as indicated were treated with or without TSA (class I/II HDAC inhibitor), or NAM (class III HDAC inhibitor) 8 h before harvesting, and analyzed by western blots. For uncropped gel source data, see .

Article Snippet: For transfection, plasmids expressing human full-length WT-p300 (Cat. 89094, addgene), and the p300 acetyltransferase activity-defective mutant (Cat. 89095, addgene) , were purchased from addgene and transfected with the Lipofectamine 3000 Reagent (Cat. L3000015, ThermoFisher).

Techniques: In Vivo, Immunoprecipitation, Western Blot, In Vitro, Incubation, Mass Spectrometry, Sequencing, Transfection

Bacterial strains and plasmids

Journal:

Article Title: Intracellular Butyryl Phosphate and Acetyl Phosphate Concentrations in Clostridium acetobutylicum and Their Implications for Solvent Formation

doi: 10.1128/AEM.71.1.530-537.2005

Figure Lengend Snippet: Bacterial strains and plasmids

Article Snippet: All bacterial strains and plasmids used in this study are listed in Table . table ft1 table-wrap mode="anchored" t5 TABLE 1. caption a7 Strain or plasmid Relevant characteristics a Source or reference b C. acetobutylicum strains ATCC 824 Wild type ATCC PJC4BK Em r , butyrate kinase mutant 12 PJC4PTA Em r , phosphate acetyltransferase mutant 12 M5 pSOL1 − 7 E. coli TOP10 Invitrogen Plasmids pJC7 Ap r , BK gene 4 pTrcHis-TOPO Ap r , overexpression vector Invitrogen pTrcHis-BK Ap r , BK overexpression This study Open in a separate window a Ap, ampicillin; Em, erythromycin. b ATCC, American Type Culture Collection, Manassas, Va; Invitrogen, Invitrogen Corporation, Carlsbad, Calif. Bacterial strains and plasmids

Techniques: Plasmid Preparation, Mutagenesis, Over Expression

(A) Work flow used to refine motif enrichment analysis and focus on enriched transcription factors (TFs) important in airway epithelial biology and BEC-SEs. (B) Ingenuity analysis indicating TFs with motif enrichment in asthma DERs and BEC-SEs were associated with various processes in epithelial biology including epithelial to mesenchymal transition (EMT). (C) Genome tracks depicting H3K27ac across loci encoding epithelium-dominant TFs encompassed by BEC-SEs and asthma DERs. Asthma=red, healthy=blue. (D) Enriched motifs and matching TFs identified by HOMER (see methods). (E) H3K27ac profiles of healthy (blue) and asthma (red) BECs at epithelium-dominant TF binding sites identified via ChIP-Seq and those predicated by HOMER (*; see also ) (F) TLR3 gene expression could be induced with single DER-specific gRNAs in an acetylation-dependent manner (n=3, Mean ±SEM). (G) Genome tracks depicting H3K27ac in BECs across the SERPINB2 . Acetylation (dCas9-P300-Core) was targeted to the TSS (pool 1) of SERPINB2 and upstream within an asthma-associated SE (pools 2-4) using gRNAs (yellow boxes top tracks). No induction of gene expression was observed when targeting distal enhancer elements. Guide RNAs to IL1RN used as controls. Core - only P300 constructs transfected (n=3, Mean ±SEM, ** P <0.01, ANOVA/Tukeys multiple comparisons).

Journal: bioRxiv

Article Title: Genome-wide profiling of an enhancer-associated histone modification reveals the influence of asthma on the epigenome of the airway epithelium

doi: 10.1101/282889

Figure Lengend Snippet: (A) Work flow used to refine motif enrichment analysis and focus on enriched transcription factors (TFs) important in airway epithelial biology and BEC-SEs. (B) Ingenuity analysis indicating TFs with motif enrichment in asthma DERs and BEC-SEs were associated with various processes in epithelial biology including epithelial to mesenchymal transition (EMT). (C) Genome tracks depicting H3K27ac across loci encoding epithelium-dominant TFs encompassed by BEC-SEs and asthma DERs. Asthma=red, healthy=blue. (D) Enriched motifs and matching TFs identified by HOMER (see methods). (E) H3K27ac profiles of healthy (blue) and asthma (red) BECs at epithelium-dominant TF binding sites identified via ChIP-Seq and those predicated by HOMER (*; see also ) (F) TLR3 gene expression could be induced with single DER-specific gRNAs in an acetylation-dependent manner (n=3, Mean ±SEM). (G) Genome tracks depicting H3K27ac in BECs across the SERPINB2 . Acetylation (dCas9-P300-Core) was targeted to the TSS (pool 1) of SERPINB2 and upstream within an asthma-associated SE (pools 2-4) using gRNAs (yellow boxes top tracks). No induction of gene expression was observed when targeting distal enhancer elements. Guide RNAs to IL1RN used as controls. Core - only P300 constructs transfected (n=3, Mean ±SEM, ** P <0.01, ANOVA/Tukeys multiple comparisons).

Article Snippet: Plasmids encoding active and mutant forms of a deactivated-Cas9-histone acetyltransferase P300 fusion protein (pcDNA-dCas9-p300 Core, pcDNA-dCas9-p300 Core-D1399Y) and guide RNA only expression vector (phU6-gRNA) were gifts from Charles Gersbach( )(Addgene #61357, #61358 and #53188 respectively).

Techniques: Binding Assay, ChIP-sequencing, Expressing, Construct, Transfection

(A) Plots generated by BETA analysis depicting the relationship between DERs and differential gene expression (DE) in asthma. Overall, gain and loss of H3K27ac was associated with transcriptional activation (up regulated genes - red) and repression (down regulated genes - green) in asthma respectively. However, this was more strongly related to distance of DERs to DE genes. (B) Plots showing distribution of H3K27ac enrichment for all DERs associated with DE genes identified in BECs. (** P <0.01, Kolmogorov-Smirnov test). (C) Heatmap depicting both gain and loss of H3K27ac across study volunteers for DERs within 150kb of DE genes up and down regulated in asthma. (D) Graph summarizing number of asthma DERs associated with DE genes by distance (25kb bins) and direction of gene expression in asthma (i.e. up or down regulated). Plots showing changes in H3K27ac enrichment are evident at selected regions up and downstream from DE gene TSSs (* P <0.05, Kolmogorov-Smirnov test). (E) Genome tracks depicting H3K27ac in BECs and long-range chromosomal interactions in whole lung (top track) across the CLCA1 locus. Although exhibiting minimal H3K27ac in BECs, CLCA1 interacts with asthma DERs spanning ∼200kb (purple arcs) including those near CLCA3P and an asthma-SE at CLCA2 (highlighted in red). Note no change in H3K27ac is evident at SH3GLB1 (star). (F) Genome tracks depicting H3K27ac across TLR3 and location of DER-specific gRNAs (top track - orange lines). Regions of ‘open chromatin’ identified in BECs are depicted in the bottom track (DNase hypersensitivity sites - DHS). Dot plots depicting H3K27ac enrichment of DER targeted by gRNAs across healthy (blue) and asthma volunteers (** P <0.01, DiffBind). (G) Using a CRISPR-based approach, acetylation (dCas9-P300-Core) was targeted to an asthma-DER at TLR3 using pooled guide RNAs. Increased P300 indicated successful delivery and expression of dCas9 constructs across all gRNA pools. However, TLR3 gene expression was selectively induced in a DER-specific gRNA and acetylation-dependent manner. A pool of non-DER-targeting gRNAs to IL1RN were used as control. Core - only P300 constructs transfected (n=3, Mean ±SEM, *** P <0.001, ANOVA/Tukeys multiple comparisons).

Journal: bioRxiv

Article Title: Genome-wide profiling of an enhancer-associated histone modification reveals the influence of asthma on the epigenome of the airway epithelium

doi: 10.1101/282889

Figure Lengend Snippet: (A) Plots generated by BETA analysis depicting the relationship between DERs and differential gene expression (DE) in asthma. Overall, gain and loss of H3K27ac was associated with transcriptional activation (up regulated genes - red) and repression (down regulated genes - green) in asthma respectively. However, this was more strongly related to distance of DERs to DE genes. (B) Plots showing distribution of H3K27ac enrichment for all DERs associated with DE genes identified in BECs. (** P <0.01, Kolmogorov-Smirnov test). (C) Heatmap depicting both gain and loss of H3K27ac across study volunteers for DERs within 150kb of DE genes up and down regulated in asthma. (D) Graph summarizing number of asthma DERs associated with DE genes by distance (25kb bins) and direction of gene expression in asthma (i.e. up or down regulated). Plots showing changes in H3K27ac enrichment are evident at selected regions up and downstream from DE gene TSSs (* P <0.05, Kolmogorov-Smirnov test). (E) Genome tracks depicting H3K27ac in BECs and long-range chromosomal interactions in whole lung (top track) across the CLCA1 locus. Although exhibiting minimal H3K27ac in BECs, CLCA1 interacts with asthma DERs spanning ∼200kb (purple arcs) including those near CLCA3P and an asthma-SE at CLCA2 (highlighted in red). Note no change in H3K27ac is evident at SH3GLB1 (star). (F) Genome tracks depicting H3K27ac across TLR3 and location of DER-specific gRNAs (top track - orange lines). Regions of ‘open chromatin’ identified in BECs are depicted in the bottom track (DNase hypersensitivity sites - DHS). Dot plots depicting H3K27ac enrichment of DER targeted by gRNAs across healthy (blue) and asthma volunteers (** P <0.01, DiffBind). (G) Using a CRISPR-based approach, acetylation (dCas9-P300-Core) was targeted to an asthma-DER at TLR3 using pooled guide RNAs. Increased P300 indicated successful delivery and expression of dCas9 constructs across all gRNA pools. However, TLR3 gene expression was selectively induced in a DER-specific gRNA and acetylation-dependent manner. A pool of non-DER-targeting gRNAs to IL1RN were used as control. Core - only P300 constructs transfected (n=3, Mean ±SEM, *** P <0.001, ANOVA/Tukeys multiple comparisons).

Article Snippet: Plasmids encoding active and mutant forms of a deactivated-Cas9-histone acetyltransferase P300 fusion protein (pcDNA-dCas9-p300 Core, pcDNA-dCas9-p300 Core-D1399Y) and guide RNA only expression vector (phU6-gRNA) were gifts from Charles Gersbach( )(Addgene #61357, #61358 and #53188 respectively).

Techniques: Generated, Expressing, Activation Assay, CRISPR, Construct, Transfection